| |
| | J Clin Invest. 2005 September 1; 115(9): 2373–2381. Published online 2005 August 25. doi: 10.1172/JCI25118.Copyright © 2005, American Society for Clinical Investigation Activating and deactivating mutations
in the receptor interaction site of GDF5 cause symphalangism or brachydactyly type A2 Petra Seemann,1,2,3 Raphaela Schwappacher,3 Klaus W. Kjaer,4 Deborah Krakow,5 Katarina Lehmann,1 Katherine Dawson,5 Sigmar Stricker,1,2 Jens Pohl,6 Frank Plöger,6 Eike Staub,2 Joachim Nickel,7 Walter Sebald,7 Petra Knaus,3 and Stefan Mundlos1,2 1Institut für Medizinische Genetik, Charité, Universitätsmedizin Berlin, Berlin, Germany. 2Max-Planck-Institut für Molekulare Genetik, Berlin, Germany. 3Institut für Chemie-Biochemie, Freie Universität Berlin, Berlin, Germany. 4Wilhelm
Johannsen Centre for Functional Genome Research, Department of Medical
Biochemistry and Genetics, University of Copenhagen, Copenhagen,
Denmark. 5Department of Obstetrics and Gynecology, Cedars-Sinai Research Institute, Los Angeles, California, USA. 6Biopharm GmbH, Heidelberg, Germany. 7Institut für Physiologische Chemie II, Biozentrum, Universität Würzburg, Würzburg, Germany. Received March 23, 2005; Accepted June 21, 2005. |
| Here we describe 2 mutations in growth and differentiation factor 5 (GDF5)
that alter receptor-binding affinities. They cause brachydactyly type
A2 (L441P) and symphalangism (R438L), conditions previously associated
with mutations in the GDF5 receptor bone morphogenetic protein receptor type 1b (BMPR1B) and the BMP antagonist NOGGIN,
respectively. We expressed the mutant proteins in limb bud micromass
culture and treated ATDC5 and C2C12 cells with recombinant GDF5. Our
results indicated that the L441P mutant is almost inactive. The R438L
mutant, in contrast, showed increased biological activity when compared
with WT GDF5. Biosensor interaction analyses revealed loss of binding
to BMPR1A and BMPR1B ectodomains for the L441P mutant, whereas the
R438L mutant showed normal binding to BMPR1B but increased binding to
BMPR1A, the receptor normally activated by BMP2. The binding to NOGGIN
was normal for both mutants. Thus, the brachydactyly type A2 phenotype
(L441P) is caused by inhibition of the ligand-receptor interaction,
whereas the symphalangism phenotype (R438L) is caused by a loss of
receptor-binding specificity, resulting in a gain of function by the
acquisition of BMP2-like properties. The presented experiments have
identified some of the main determinants of GDF5 receptor-binding
specificity in vivo and open new prospects for generating antagonists
and superagonists of GDF5. |
| The
development of the appendicular skeleton follows a sequence of highly
regulated events beginning with the condensation of skeletal precursor
cells and their subsequent differentiation into chondrocytes (1).
This process is controlled by a complex molecular network of signaling
pathways, one of the most prominent being the signaling cascade of the
TGF-β superfamily. To date, at least 25 different bone morphogenetic
proteins (BMPs) and growth and differentiation factors (GDFs) that
belong to this superfamily have been described (2).
Like all BMPs, GDF5 is synthesized as a larger precursor molecule that
is subsequently processed to mature proteins that form homo- and
heterodimers with other BMPs. The mature domain is highly conserved
between BMPs and GDFs, which contain 7 cysteine residues; 6 of these
form intrachain disulfide bonds, creating a rigid 3D cysteine-knot
structure, whereas the fourth of the 7 cysteines is needed for
dimerization (3). Part of the
necessary specificity of BMP action is ensured by differential
affinities of distinct ligands to their receptors. Signaling of the
TGF-β superfamily members requires the binding of the ligand to cell
surface receptors consisting of 2 types of transmembrane
serine/threonine kinase receptors classified as type 1 and type 2. For
example, BMP2 binds with high affinity to the BMP receptors type 1A
(BMPR1A) and type 1B (BMPR1B) whereas GDF5 preferentially binds to
BMPR1B (4, 5).
Intracellular effectors of the activated type 1 receptors are the SMADs
that, when phosphorylated by the receptors, translocate to the nucleus,
where they participate in the transcriptional regulation of genes
involved in cartilage and bone formation (6–8). Analysis of the brachypod (bp) mouse mutant showed that Gdf5 has a key role in chondrocyte differentiation and joint formation (9). Gdf5bp-J
mice are characterized by a severe limb reduction phenotype consisting
of shortening of the humerus and femur, hypoplasia of all phalanges and
metacarpals, and lack of interphalangeal joints. This and the
expression of Gdf5 in the areas of the joint interzone suggest a specific role in joint formation. However, Gdf5
is initially expressed in cells surrounding the condensations, and
overexpression results in broader and longer cartilage but not in the
formation of additional joints (10, 11). Furthermore, the abnormalities observed in Gdf5bp-J mice appear to be due to a defect in early chondrogenesis that results in smaller condensations (12).
Thus, it is unlikely that the major role of Gdf5 is to specify joints.
Rather, the molecule elicits its function by increasing the
proliferation rate and recruitment of mesenchymal precursor cells (13).
The chondrogenic potential of GDF5 is further supported by the finding
that GDF5 administered subcutaneously or intramuscularly on carrier
matrices induces cartilage and bone or dense connective tissue
formation reminiscent of that in ectopic tendon (14, 15).
Consequently, GDF5 has been considered for use as a pharmaceutical
agent to induce cartilage and bone in, for example, a spinal fusion
model (16). Mutations in human GDF5 result in skeletal malformation syndromes including brachydactyly type C (BDC) (OMIM 113100) (17),
a condition characterized by shortening of digits and hypersegmentation
of phalanges, and the recessive acromesomelic dysplasias of the
Hunter-Thompson, Grebe, and DuPan types, which are characterized by
short stature, severe limb shortening, and profound brachydactyly (18–20). The great majority of mutations in GDF5
described so far are nonsense and frame shift mutations that presumably
result in a complete loss of function. Dominant and recessive mutations
in the prodomain of GDF5 have been described, but their role in the pathogenesis of BDC remains to be shown (21). Mutations in BMPR1B,
the high-affinity receptor for GDF5, cause brachydactyly type A2 (BDA2)
(OMIM 112600), a condition characterized by shortening of the index
finger due to hypoplasia/aplasia of the middle phalanx (22).
As shown by in vitro and in vivo overexpression studies, BDA2 mutations
act in a dominant-negative manner by interfering with type 2
receptor–mediated transphosphorylation. In contrast, BMPR1B loss-of-function mutations are recessive and phenotypically more similar to homozygous GDF5 mutations (23). Inactivation of Bmpr1b in the mouse results in a comparable phenotype (24, 25). The
biological availability and thus activity of GDFs and BMPs is in part
regulated by binding to strong inhibitors such as NOGGIN (NOG),
CHORDIN, or GREMLIN (26). The inactivation of Nog in the mouse results in a massive overproduction of cartilage and a complete loss of joint formation (27). Heterozygous loss-of-function mutations in human NOG
have a similar albeit less severe effect that causes proximal
symphalangism (SYM1) (OMIM 185800), carpal-tarsal coalition syndrome
(TCC) (OMIM 186570), and multiple synostosis syndrome (SYNS1) (OMIM
186500) (28–31).
All 3 conditions are characterized by the absence of joint cartilage
and bony fusions of the affected elements. Thus, mutations interfering
with the stochiometry of the BMP–BMP-inhibitor complex result in
brachydactyly and abnormal joint formation. Here we present the molecular analysis of 2 mutations in GDF5
that give rise to opposing phenotypes, brachydactyly with shortening or
loss of phalanges and SYM1 with joint fusions. The 2 mutations are
located in close proximity to each other within the
receptor-interaction interface. The brachydactyly mutation (L441P)
results in a loss of function through a reduced binding affinity to the
BMPR1B receptor, whereas the SYM1 mutation (R438L) causes increased
activity in all functional tests, a gain of function likely mediated
through higher binding affinity to the BMPR1A receptor. |
| Point mutations in GDF5 result in BDA2 and proximal SYM1. BDA2
was clinically diagnosed in patients from a large pedigree who showed
short index fingers and variable clinodactyly. X-rays showed hypoplasia
or aplasia of the second phalanx of digit II and, to a variable extent,
shortening and shape abnormalities of the middle phalanx of digit V.
The phenotype was very similar to that in previously published cases of
BDA2, but mutations in BMPR1B could not be identified. By screening for candidate genes, we identified a heterozygous T1322C mutation in GDF5
in all affected members of the family, resulting in the exchange of
leucine at position 441 to proline (L441P). The phenotype is shown in
Figure 1A. For comparison, the phenotype of an individual with a mutation in BMPR1B, as previously described (22), is also shown. In
a second family, SYM1 was diagnosed on the basis of patients’ inability
to bend fingers IV and V in their interphalangeal joints and loss of
flexion creases at the corresponding sites. X-rays of the hands showed
a complete bony fusion between the proximal and middle phalanges of
digit V and, to a lesser extent, digit IV. Screening for mutations in NOG, the gene known to be mutated in SYM1, showed no mutation. However, sequencing GDF5
revealed a change of G to T at position 1632 in all affected members of
the family, resulting in the exchange of arginine at position 438 to
leucine (R438L). The phenotype is shown in Figure 1C. For comparison, the phenotype of an individual with SYM1 and a mutation in NOG (28) is also shown. R438L and L441P mutations are located within the receptor interaction site. To
study evolutionary conservation and to predict specific functions for
the amino acid residues at the mutated sites, a multiple alignment
between the highly conserved signaling domains of GDF5 and BMPs of
different species was constructed. As shown in Figure 2A,
both sites are completely conserved in GDF5 proteins of distantly
related species. L441 is conserved in other members of the BMP family
such as BMP2 or BMP4. In contrast, R438 is only present in members of
the GDF family, whereas all BMPs including the drosophila BMP homolog
decapentaplegic (DPP) have an alanine at this position. We used the
BMP2-BMPR1A structure (Protein Data Bank [PDB] entry 1REW; http://www.rcsb.org/pdb/) as a model to simulate GDF5-BMPR1B interaction (Figure 2B).
The alignment allowed us to locate homologous residues of GDF5 in the
BMP2 structure. The mutated residues R438 and L441 are located within
the receptor interaction interface of GDF5 (Figure 2C). Functional analysis of GDF5 mutants in micromass culture. To analyze the functional consequences of the GDF5
mutations, we infected chicken micromass cultures with
replication-competent avian sarcoma (RCAS) viruses expressing WT Gdf5
and mutated Gdf5 and measured cell differentiation and cartilaginous
matrix production by alkaline phosphatase (ALP) and Alcian blue. As
expected, infection of micromass cells with WT GDF5–expressing virus
resulted in a massive induction of cartilage production as indicated by
the increase in Alcian blue and ALP staining (Figure 3).
In contrast, infection with the L441P mutant construct resulted in a
moderate increase in staining and very little induction of ALP, which
might be a secondary effect of increased proliferation. Infection with
the R438L mutant resulted in strong induction of Alcian blue and ALP at
levels similar to those found in WT Gdf5. Coinfection of cultures with
Gdf5 (WT and mutants) and Nog completely inhibited cartilage formation. Analysis of receptor specificity of GDF5 mutants in cell culture. To
further analyze the specific interaction of the mutants with the 2
different type 1 receptors, we constructed expression vectors encoding
the GDF5 mutants and produced human recombinant mature GDF5. The
protein was shown to be pure by silver-stained PAGE analysis. To
identify functional differences among the group of mutants and between
the mutants and WT Gdf5, we treated a chondrogenic progenitor cell line
(ATDC5) and a premyoblastic cell line (C2C12) with the respective
recombinant proteins. As shown in Figure 4A,
treatment of ATDC5 cells with WT GDF5 protein resulted, as previously
described, in an induction of ALP activity. In this system, BMP2 was
even more potent when compared with GDF5. Stimulation of cells with the
R438L mutant resulted in a strong ALP induction at levels similar to
those in BMP2, indicating a gain of function for this mutant. In
contrast, treatment with the L441P mutant caused only a low degree of
induction, significantly less than with WT GDF5. Thus the L441P mutant
has almost no activation capacity. To test the effect of the L441P
mutant on WT GDF5, we stimulated cells with 10 nM WT GDF5 and added
increasing amounts of L441P mutant (Figure 4B).
The results showed neither an increase nor a decrease in ALP activity,
with rising concentrations of the mutant indicating that L441P in this
setting has no influence on WT GDF5 signaling. The induction of ALP
activity by BMP2 was suppressed by the addition of recombinant NOG.
Suppression was also obtained with WT GDF5 and the R438L mutant,
suggesting that NOG was still able to effectively bind and inactivate
the mutant (Figure 4C). However, GDF5 appeared to be inhibited less efficiently than BMP2. C2C12 cells showed strong induction after treatment with BMP2 but practically no response when treated with WT GDF5 (Figure 5A).
The R438L mutant resulted in ALP induction significantly higher than
that achieved with WT GDF5. C2C12 cells are mesenchymal progenitor
cells that have the potential to differentiate into muscle cells,
osteoblasts, or adipocytes. We made use of this quality by staining for
osteogenesis (ALP activity) and myogenesis (myosin expression) to test
the ability of the GDF5 mutants to direct cell differentiation (Figure 5C).
Untreated cells differentiated into myocytes, but treatment with BMP2
resulted in strong induction of ALP, inducing osteogenesis. Treatment
with GDF5 had no major effect, but the myotubes appeared smaller than
in untreated cells. Inhibition of endogenous Bmp activity by NOG
strongly increased the amount of myosin-positive cells. Similar results
were obtained for the L441P mutant. Treatment of C2C12 cells with the
R438L mutant, however, resulted in strong induction of ALP and
suppression of myoblast formation, indicating that this mutant has a
BMP2-like effect. We quantified ALP activity photometrically and showed
that WT GDF5 and the L441P mutant had no effect whereas the R438L
mutant resulted in ALP induction, albeit less than with WT BMP2. To
test a dominant effect of the L441P mutant on BMP2, we treated cells
with 5 nM BMP2 and increasing amounts of mutant protein. For
comparison, we performed the same experiment for NOG and WT GDF5
(Figure 5B).
The inductive activity of BMP2 was substantially suppressed by adding
increasing concentrations of NOG. Likewise, the addition of L441P
mutant resulted in BMP2 suppression, indicating that the mutant
interfered with BMP2 signaling. The addition of WT GDF5 resulted in a
small reduction of ALP activity, but overall there was no detectable
major effect. Thus in this setting the L441P mutant inhibited
BMP2-induced ALP activity with higher efficiency than WT GDF5. Measurements of protein-protein binding. To
further analyze ligand-receptor binding, we performed binding studies
of the WT GDF5 and mutant GDF5 proteins to immobilized receptor
ectodomains using the BIA2000 system. As shown in Table 1,
WT GDF5 demonstrated low binding affinity to BMPR1A but high affinity
to BMPR1B and NOG. The L441P mutant showed a strong reduction in
binding affinity to BMPR1B, and its binding affinity to BMPR1A was
below detection level. Normal affinity was found for NOG. In contrast,
the R438L mutant showed strong binding to all 3 components tested,
i.e., BMPR1A, BMPR1B, and NOG. These results further support our
previous findings in cell culture and demonstrate that the R438L mutant
has lost its specificity for BMPR1B and is able to signal through the
BMPR1A receptor as well. Expression analysis of Gdf5 pathway components and overexpression of Gdf5 mutants in vivo. To
localize the expression of ligands and receptors during joint
development, we performed in situ hybridization using probes specific
for Gdf5, Bmp2, Bmpr1a, Bmpr1b, and Nog on mouse limbs at stages E13.5 and E14.5 (Figure 6A). We found Bmpr1a to be ubiquitously expressed with higher levels in the developing joint, as previously reported (32). In contrast, Bmp2 expression was absent from the joint region at E13.5 and did not appear until E14.5. As shown in Figure 6A,
expression was observed around the joint area in 2 stripes. However,
this expression domain was shown to correspond to developing tendons
and was thus oriented along the longitudinal axis of the digit and not
the transverse axis, as expected for a gene expressed in the joint. At
E14.5, we observed Bmp2 expression in a small band of cells
in the middle of the joint cavity that is known to subsequently undergo
apoptosis. At E13.5, Nog was expressed in the ends of the
phalangeal anlagen, sparing the future joint, with the exception of a
small band of cells in the middle of the joint interzone. Nog expression in the joint interzone disappears at E14.5 and is then replaced by expression of Bmp2. Furthermore, this is the only domain where the expression patterns of Nog and Gdf5 overlap. The inhibition of Gdf5 in these cells is likely to pave the way for interzone formation. To
analyze the effect of the Gdf5 mutants in vivo, we overexpressed WT
Gdf5 and mutant Gdf5 in chick embryos using the RCAS retroviral system
(Figure 6B).
Overexpression of WT Gdf5 as well as the R438L mutant resulted in
thickening of skeletal anlagen as well as in the fusion of joints as
demonstrated by Alcian blue–stained skeletal preparations of Hamburger
Hamilton stage 32 (HH32) embryos. As expected from our in vitro
results, overexpression of the L441P mutant had very little effect, and
no significant phenotype was observed at this stage. However, single
joint fusions and a moderate enlargement of distal phalanges was
observed after longer incubation times (a day later at HH34–35),
indicating some residual activity of the L441P mutant. |
| The
present work describes 2 mutations in the BMP-like signaling molecule
GDF5 that give rise to the human limb malformation syndromes BDA2 and
SYM1, previously shown to be associated with mutations in BMPR1B and NOG,
respectively. Prediction of the GDF5 structure based on the known
structure of the BMP2–BMPR1A complex implied that both mutations are
located within the interaction interface of ligand and receptor. We
therefore hypothesized that the GDF5 mutants display altered
receptor-binding affinities and by this mechanism interfere with
regular GDF5 signaling. We performed binding studies with the GDF5
mutants and showed that the L441P mutant has a dramatically reduced
affinity to BMPR1B. In contrast, no difference in binding to NOG was
observed, confirming that the gross tertiary structure of the mutant
was not significantly altered. In accordance with these findings, we
observed a severe reduction of chondrocyte differentiation and
cartilage formation by the L441P mutant in our cell assays, suggesting
lack of signaling through BMPR1B. However, the mutation is unlikely to
result in complete inactivation because loss-of-function mutations in GDF5 cause BDC, a condition characterized by a distinct and more severe phenotype (33). Ligand
cross-linking experiments showed that GDF5 binds efficiently to singly
expressed type 2 and type 1b receptors, but positive signaling activity
was only detected when both receptors were present (4).
More recent studies have shown that BMP receptors (types 1a, 1b, and 2)
form homomeric and heteromeric complexes even in the absence of ligand
and that both type 1 receptors have similar affinities to their ligands
(34, 35).
Since the L441P mutation affects only the type 1 receptor-binding site,
the mutant should still be able to bind to the BMPR2 receptor and may
consequently elicit a negative effect on the entire ligand-receptor
complex. This effect is likely to be intensified by the fact that 75%
of the GDF5 dimer molecules will contain at least 1 mutated molecule.
The L441P mutation reported here to cause BDA2 was previously described
in a cosanguineous Pakistani family with recessive DuPan syndrome (20).
This condition also belongs to the group of acromesomelic dysplasias
but is less severe than the Grebe and Hunter-Thompson dysplasias. The
DuPan phenotype resembles a homozygous loss-of-function mutation in BMPR1B, as recently described (23). Thus, the similarities between the L441P-associated phenotypes and those associated with BMPR1B
mutations are striking and strongly support our conclusion that the
L441P mutation results in a selective loss of GDF5 signaling through
the BMPR1B receptor. Differences between BDC and the L441P phenotype on
one hand and DuPan and BMPR1B-associated phenotype on the other are
likely to be due to the binding of GDF5 to other receptors and/or
negative effects of the L441P mutant on the entire signaling cascade. The R438L mutation described here causes a phenotype indistinguishable from that observed in individuals with NOG mutations (28).
However, as shown in cell culture and by our in vitro binding assays,
binding of the R438L mutant to NOG was unaltered in spite of the fact
that R438 lies within the NOG interaction region, making it unlikely
that the SYM1 phenotype described here is caused by an abnormal
interaction of the mutant protein with NOG. Structural and mutational
analysis of the BMP2 and BMPR1A binding sites revealed a specific type
of protein-protein interface consisting of a large hydrophobic contact
area (36). The residues L51 and
D53 (corresponding to L437 and S439 in GDF5, respectively) are
particularly exposed and essential for binding to BMPR1A.
Interestingly, R438 resides between these 2 residues within this
receptor interaction site. R438 is conserved throughout species and
within different GDFs but differs markedly in other BMPs, including the
drosophila BMP analog DPP, in which the positively charged amino acid
arginine is replaced by the nonpolar and hydrophobic alanine. In the
mutant, R438 is replaced by the hydrophobic residue leucine, resulting
in a GDF5 with BMP2-like properties. Mutagenesis of these sites in BMP2
has shown altered binding affinities for BMPR1A (5).
For example, converting L51 into proline resulted in a complete loss of
binding to the type 1 receptor but normal binding to NOG and the type 2
receptor (36). Our binding
studies show that the R438L mutant is still able to bind to BMPR1B with
high affinity. However, in contrast to WT GDF5, the mutant is also able
to bind to BMPR1A, albeit with lower affinity than BMP2. Thus the R438L
mutation converts GDF5 into a molecule with BMP2-like properties. This
hypothesis is supported by our cell assays. The R438L mutant is highly
active in all tests and appears to be even more potent than WT GDF5.
The major difference between the mutant and the WT protein, however,
becomes apparent through testing the differentiation of C2C12 cells
into osteoblasts versus myoblasts. C2C12 cells are mesenchymal
progenitor cells that spontaneously differentiate into muscle cells
when reaching confluence. Treatment with BMPs resulted in
differentiation along the osteoblastic lineage, as shown by a drastic
increase in ALP activity. GDF5 has no effect on this phenomenon,
presumably because Bmpr1b is, in contrast to Bmpr1a, nearly absent in
C2C12 cells (2). In this assay,
the R438L mutant behaves like BMP2, thus inducing osteoblastic
differentiation and inhibiting muscle differentiation. We conclude that
the R438L mutant GDF5 binds to both BMPR1A and BMPR1B, loses its
preferential binding to BMPR1B, and thus takes on receptor affinities
similar to those of BMP2. The consequences of this double
signaling activity of the R438L mutant can be 2-fold. First, as shown
in our in vitro assays, the mutant is likely to be more active and will
thus enhance the natural function of WT GDF5. Second, the activation of
the BMP2/BMPR1A pathway may result in aberrant signaling interfering
with the normal function of GDF5. In situ hybridization experiments on
developing joints in the mouse indicated that signaling through the 1a
receptor is possible within the Gdf5 expression domain. Bmp2-induced
signaling was tightly regulated on the level of expression and the
local release of inhibitors such as Chordin and Nog, indicating that
the activation of aberrant Bmp2-like signaling is likely to result in a
disturbance of joint formation. To study a gain of function in vivo, we
overexpressed WT Gdf5 and mutant Gdf5 in chicken limb buds. We observed
joint fusions and overall enlargements of the cartilaginous anlagen
similar to that found in previous studies (10)
consistent with the proposed function of Gdf5 as a cartilage inducer.
Similar results were obtained for WT Gdf5 and mutant Gdf5, indicating
that the mutant proteins retained WT activity. Treatment of limb buds
by implantation of BMP2-soaked beads resulted in the induction of
apoptosis similar to that in vivo, in which BMPs are thought to be
involved in the regulation of apoptosis in the interdigital mesenchyme (11, 37). In particular, Bmp2 is able to induce apoptosis through a Smad-independent, PKC-dependent signaling pathway (38).
We did not observe an increase in apoptosis when expressing WT Gdf5 and
mutant Gdf5 in chick limbs, which shows that the increased activity of
the R438L mutant had no major effect on this pathway. These results
indicate that the R438L mutant elicits its pathology through a gain of
function, probably by recruiting additional type 1a receptors expressed
in the region at the critical time of joint formation. Thus, as shown
schematically in Figure 7,
the lack of joint formation observed in SYM1 was induced either by
overactive GDF5 or by downregulated NOG. Both result in an imbalance of
signal versus inhibitor, leading to the persistence of cartilage in the
future joint interzone. In this model, proliferation and recruitment of
mesenchymal cells caused by GDF5 is inhibited by NOG in the center of
the joint interzone, resulting in dedifferentiation of interzone cells.
The subsequent downregulation of NOG expression in these cells and the
upregulation of BMP2 expression finally permit apoptosis and joint
formation. In contrast, selective inhibition of GDF5 as in the L441P
mutant primarily affects longitudinal growth and thus causes shortening
or loss of individual skeletal elements. The study of the
mutations described here extends our knowledge of human GDF5-related
phenotypes. Furthermore, the functional analysis showed that mutations
in different genes of the same pathway can result in identical
phenotypes, provided the mutations have similar effects on the affected
signals. Inactivation of the ligand-receptor complex as in BMPR1B receptor mutants causes a BDA2 phenotype identical to the L441P mutation in GDF5
described here. Likewise, the phenotype caused by inactivation of the
BMP-antagonist NOG can be mimicked by a gain-of-function mutation in GDF5
that results from a loss of signaling specificity. The present
experiments localize some of the main determinants of GDF5-binding
specificity, suggesting that GDF5 with altered binding affinities may
function as an inhibitor of BMP signaling. The study of such mutated
GDF5 peptides may improve our ability to make use of the
pharmacological properties of GDF5 in the clinical applications of
fracture healing and tendon and nerve regeneration. |
| Patients. One
family from Norway and 1 family from the US, whose members experienced
BDA2 and SYM1, respectively, were investigated. DNA was extracted with
standard methods from peripheral blood or buccal swabs. Sequencing of GDF5, NOG, and BMPR1B was performed as described previously (17, 21, 22, 28). All participants gave informed consent. Alignment and 3D structure prediction of GDF5. Protein
sequence alignments comprising the highly conserved cysteine knot
domains of 10 members of the GDF5, BMP2, and BMP4 family and from DPP
(drosophila DPP) were aligned using CLUSTAL X
(http://bio.ifom-firc.it/docs/clustal/clustalx.html) (39) and colored using CHROMA (http://www.lg.ndirect.co.uk/chroma/) (40). The 3D structure prediction of GDF5 was generated by the 3D-PSSM server (http://www.sbg.bio.ic.ac.uk/∼3dpssm/index2.html) (41) using the BMP2 structure (PDB entry 3BMP)
as a template. Images of the molecular structure were produced using
the UCSF Chimera package (http://www.cgl.ucsf.edu/chimera/) (42). In situ hybridization. In
situ hybridization was performed on 7-μm sections of paraffin-embedded
mouse limbs, stage E13.5 and E14.5, by using digoxygenin-labeled
riboprobes as described (43). The following previously described riboprobes were used: Bmp2 (32), Bmpr1a (44), Bmpr1b (24), Gdf5 (43), and Nog (45).
All animal experiments were approved by the ethics committee of the
Landesamt für Arbeitsschutz, Gesundheitsschutz, und technische
Sicherheit (Berlin, Germany). Viral constructs. The coding sequence of chicken Gdf5
was cloned into p–SLAX-13 and used as a template for generating the
R438L and L441P mutations corresponding to the human mutations. In
vitro mutagenesis was performed with the Quickchange Kit (Stratagene)
according to the manufacturer’s recommendations. Cloning into the RCAS
vector was performed as described previously (46). RCAS-Nog was a kind gift from A. Vortkamp (Max-Planck-Institut für Molekulare Genetik). Micromass cultures. Micromass cultures were prepared as described previously (22)
with minor modifications. Briefly, fertilized chicken eggs were
obtained from Tierzucht Lohmann and incubated at 37.5°C in a humidified
egg incubator for about 4.5 days. Ectoderm was removed, and cells were
isolated from the limb buds at stage HH23–24 by digestion with 0.1%
collagenase type Ia and 0.1% trypsine. Micromass cultures were plated
at a density of 2 × 105 cells/10-μl drop. Infection was
performed with 1 μl of 2 concentrated viral supernatants: RCASBP-A,
containing the cDNA encoding WT–chicken Gdf5 (WT-chGdf5), R438L-chGdf5,
or L441P-chGdf5; and RCASBP-B, containing the cDNA encoding WT-chNog.
Culture medium (DMEM-F12, 2% chicken serum, 4 mM L-glutamine,
1000 U/ml penicillin, and 100 μg/ml streptomycin) was replaced every 2
days. For each condition, 4 replicates were performed in parallel. Cell assays. Quantitative ALP assays were performed as previously described (47) with minor modifications: ATDC5 and C2C12 cells were seeded at a density of 1 × 104 cells/96-well plates in growth media (for ATDC5: DMEM/Ham’s F12, 5% FCS, 10 μg/ml transferrin, 30 nM sodium selenite, and 2 mM L-glutamine in 5% CO2; for C2C12: high-glucose DMEM, 10% FCS, and 2 mM L-glutamine in 10% CO2). After 24 hours, cells were starved for 5 hours in media with reduced FCS (for ATDC5: DMEM/Ham’s F12, 0.5% FCS, and 2 mM L-glutamine in 5% CO2; for C2C12: high-glucose DMEM, 2% FCS, and 2 mM L-glutamine in 10% CO2).
Stimulation with recombinant proteins was performed in starving media
for 3 days. ALP activity was measured in triplicate for ATDC5 and C2C12
cells in 96-well plates by lysing cells in ALP-buffer1 (0.1 M glycine,
pH 9.6, 1% Nonidet P-40 [Sigma-Aldrich], 1 mM MgCl2, and 1 mM ZnCl2).
ALP activity of micromass cultures was determined by homogenizing 4
replicates separately in ALP-buffer1; after centrifugation only
supernatant was used for further proceedings. After the addition of 1
volume of ALP-buffer2 (5 mM p-nitrophenyl phosphate [p-NPP], 0.1 M
glycine, pH 9.6, 1 mM MgCl2, and 1 mM ZnCl2), ALP
activity was determined spectrophotometrically. The amount of p-NP
released from the substrate p-NPP was recorded at 405 nm and used to
calculate ALP activity. Alcian blue staining was performed by
fixing micromass cultures at day 4, then incubating with 0.1% Alcian
blue, pH 1, overnight. Quantification of the staining was achieved
after extensive washings with water by extraction with 6 M
guanidine-HCl for 8 hours at room temperature. Dye concentration was
determined spectrophotometrically at A650. For differentiation of C2C12, cells were grown on coverslips in high-glucose DMEM supplemented with 10% FCS, 2 mM L-glutamine,
penicillin (100 U/ml), and streptomycin (100 μg/ml). Before reaching
confluence, cells were stimulated with 10 nM recombinant proteins in
high-glucose DMEM supplemented with only 2% FCS, 2 mM L-glutamine,
and penicillin/streptomycin over 5 days. ALP staining was performed to
visualize osteoblastic differentiation. Myoblastic differentiation was
analyzed by immunocytochemistry using an antibody against myosin heavy
chain (anti-myosin-IgG mouse, 1:300; Sigma-Aldrich). Detection was
achieved after extensive washings by Vectastain Kit (Vector
Laboratories) and diaminobenzidine tetrahydrochloride (DAB) staining
(Vector Laboratories) according to the manufacturer’s recommendations. Preparation of recombinant proteins. For
the expression of mutant GDF5, patient DNA carrying the R438L or L441P
mutants was amplified by PCR with specific GDF5 primer pair F_MP52_Afl
II (GCAAGAACCTTAAGGCTCGC) and R_MP52_Nco I (CGGGGTCCATGGAGTTCATC) with
Pfx DNA Polymerase (Invitrogen Corp.). The amplified DNA was ligated
into the protein expression vector pKOT277 and confirmed by DNA
sequencing. The proteins were expressed in inclusion bodies using the bacterial Escherichia coli
strain W3110BP and isolated using homogenization buffer (25 mM Tris
HCl, pH 7.3, and 10 mM EDTA, pH 8.0) and wash buffer (1 M urea, 20 mM
Tris HCl, and 5 mM EDTA, pH 8.3). After centrifugation, the inclusion
bodies were dissolved in 6 M guanidine HCl, 50 mM Tris, 150 mM NaCl,
and 3 mM DTT, pH 8.0. Further purification was carried out on a
reversed phase column Aquapore Octyl (100 × 10 mm, 20 μm, no. 186470;
Applied Biosystems) with a gradient from 100% eluent A (0.1%
trifluoroacetic acid [TFA]) to 100% eluent B (0.1% TFA, 90% CH3N) in 104 minutes (flow rate, 3 ml/min). Mutant
proteins were dissolved in buffer (6 M guanidine HCl, 50 mM Tris, 150
mM NaCl, and 3 mM DTT, pH 8.0), the protein concentration adjusted to
2.6 mg/ml, and the pH adjusted to between 8 and 9. After 2 hours
incubation at room temperature, refolding buffer [1 M NaCl, 50 mM Tris,
5 mM EDTA, 1 mM oxidized glutathione (GSSG), 2 mM glutathione (GSH),
and 33 mM 3-(3-cholamidopropyl) dimethylammonio-1-propanesulfonate, pH
9.5] were added under gentle agitation so that a final protein
concentration of 0.16 mg/ml was reached. The solution was then
incubated for 48 hours at 22°C; refolding was stopped by changing the
pH to 3–4 by adding HCl to 18% (vol/vol). After centrifugation, the
nonrefolded monomer was separated from the dimer form through a second
RP-HPLC under the same conditions. Purity was determined by a Western
blot and SDS-PAGE silver stain, and the fractions containing the
dimerized protein were pooled and lyophilized. Subsequently, the
proteins were dissolved in 10 mM HCl and stored at –80°C. BMP2 was
prepared as previously described (48). Human recombinant NOG was a kind gift from A. Economides (Regeneron Pharmaceuticals Inc.). Biosensor interaction analysis. The
BIA2000 system (Biacore) was used to record the binding of GDF5
proteins to immobilized NOG (R&D Systems) and receptor ectodomains
as described (5, 36).
In brief, the biotinylated proteins were fixed to streptavidin-coated
matrix of biosensor CM5 at a density of 200 resonance units. WT GDF5
and mutant proteins L441P or R338L at 25, 50, and 75 nM in HBS buffer
(10 mM HEPES, pH 7.4, 500 mM NaCl, 3.4 mM EDTA, and 0.005% surfactant
P20) were perfused at a flow rate of 10 μl/min at 25°C. The association
period was 5 minutes, and the dissociation period was set to 3 minutes.
Free receptors and NOG were regenerated on the biosensor by perfusion
with 4 M MgCl2. We calculated apparent Kd from the kinetic rate constants kon for association and koff for dissociation (Kd = koff/kon). Retroviral infection of chicken limbs. Production
of concentrated viral supernatant and injection into the limb field of
HH10 chicken embryos was performed as described previously (43).
The same virus preparations were used as for the micromass cultures.
Embryos were harvested between stages HH32–35 and stained with Alcian
blue to visualize cartilage. Statistical analyses and graphics. Nonlinear
regression and graphical view of enzymatic assays were determined using
GraphPad Prism version 4.00 for Windows (GraphPad Software). |
| We
thank A. Economides for the generous supply of recombinant human
NOGGIN. We acknowledge Britta Hoffmann for technical support and Lutz
Schomburg for critical remarks on the manuscript. This work was
supported by a grant from the Deutsche Forschungsgemeinschaft to S.
Mundlos and by NIH grants HD22567 and M01-RR88435 to D. Krakow.
Molecular graphics images were produced using the UCSF Chimera package
from the Resource for Biocomputing, Visualization, and Informatics at
UCSF (supported by NIH grant P41 RR-01081). |
| |
| 1. Kornak U, Mundlos S. Genetic disorders of the skeleton: a developmental approach [review] Am. J. Hum. Genet. 2003;73:447–474. [Free Full text in PMC]2. Sebald W, Nickel J, Zhang JL, Mueller TD. Molecular recognition in bone morphogenetic protein (BMP)/receptor interaction. Biol. Chem. 2004;385:697–710. [PubMed]3. Luyten FP. Cartilage-derived morphogenetic protein-1. Int. J. Biochem. Cell Biol. 1997;29:1241–1244. [PubMed] [Full Text]4. Nishitoh H, et al. Identification of type I and type II serine/threonine kinase receptors for growth/differentiation factor-5. J. Biol. Chem. 1996;271:21345–21352. [PubMed] [Free Full Text]5. Kirsch
T, Nickel J, Sebald W. BMP-2 antagonists emerge from alterations in the
low-affinity binding epitope for receptor BMPR-II. EMBO J. 2000;19:3314–3324. [Free Full text in PMC]6. Massague J, Chen YG. Controlling TGF-beta signaling. Genes Dev. 2000;14:627–644. [PubMed] [Free Full Text]7. Miyazono K, Kusanagi K, Inoue H. Divergence and convergence of TGF-beta/BMP signaling. J. Cell. Physiol. 2001;187:265–276. [PubMed] [Full Text]8. Shi Y, Massague J. Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell. 2003;113:685–700. [PubMed] [Full Text]9. Storm EE, et al. Limb alterations in brachypodism mice due to mutations in a new member of the TGF beta-superfamily. Nature. 1994;368:639–643. [PubMed] [Full Text]10. Francis-West PH, et al. Mechanisms of GDF-5 action during skeletal development. Development. 1999;126:1305–1315. [PubMed] [Free Full Text]11. Merino R, et al. Expression and function of Gdf-5 during digit skeletogenesis in the embryonic chick leg bud. Dev. Biol. 1999;206:33–45. [PubMed] [Full Text]12. Takahara M, et al. Developmental failure of phalanges in the absence of growth/differentiation factor 5. Bone. 2004;35:1069–1076. [PubMed] [Full Text]13. Archer CW, Dowthwaite GP, Francis-West P. Development of synovial joints. Birth Defects Res. C. Embryo Today. 2003;69:144–155. [PubMed] [Full Text]14. Erlacher L, et al. Cartilage-derived morphogenetic proteins and osteogenic protein-1 differentially regulate osteogenesis. J. Bone Miner. Res. 1998;13:383–392. [PubMed]15. Wolfman
NM, et al. Ectopic induction of tendon and ligament in rats by growth
and differentiation factors 5, 6, and 7, members of the TGF-beta gene
family. J. Clin. Invest. 1997;100:321–330. [Free Full text in PMC]16. Spiro
RC, Thompson AY, Poser JW. Spinal fusion with recombinant human growth
and differentiation factor-5 combined with a mineralized collagen
matrix. Anat. Rec. 2001;263:388–395. [PubMed] [Full Text]17. Polinkovsky A, et al. Mutations in CDMP1 cause autosomal dominant brachydactyly type C. Nat. Genet. 1997;17:18–19. [PubMed] [Full Text]18. Thomas JT, et al. Disruption of human limb morphogenesis by a dominant negative mutation in CDMP1. Nat. Genet. 1997;17:58–64. [PubMed] [Full Text]19. Thomas JT, et al. A human chondrodysplasia due to a mutation in a TGF-beta superfamily member. Nat. Genet. 1996;12:315–317. [PubMed] [Full Text]20. Faiyaz-Ul-Haque
M, et al. Mutation in the cartilage-derived morphogenetic protein-1
(CDMP1) gene in a kindred affected with fibular hypoplasia and complex
brachydactyly (DuPan syndrome). Clin. Genet. 2002;61:454–458. [PubMed] [Full Text]21. Schwabe GC, et al. Brachydactyly type C caused by a homozygous missense mutation in the prodomain of CDMP1. Am. J. Med. Genet. 2004;124A:356–363. 22. Lehmann K, et al. Mutations in bone morphogenetic protein receptor 1B cause brachydactyly type A2. Proc. Natl. Acad. Sci. U. S. A. 2003;100:12277–12282. [Free Full text in PMC]23. Demirhan O, et al. A homozygous BMPR1B mutation causes a new subtype of acromesomelic chondrodysplasia with genital anomalies. J. Med. Genet. 2004;42:314–317. 24. Baur
ST, Mai JJ, Dymecki SM. Combinatorial signaling through BMP receptor IB
and GDF5: shaping of the distal mouse limb and the genetics of distal
limb diversity. Development. 2000;127:605–619. [PubMed] [Free Full Text]25. Yi
SE, Daluiski A, Pederson R, Rosen V, Lyons KM. The type I BMP receptor
BMPRIB is required for chondrogenesis in the mouse limb. Development. 2000;127:621–630. [PubMed] [Free Full Text]26. Balemans W, Van Hul W. Extracellular regulation of BMP signaling in vertebrates: a cocktail of modulators [review] Dev. Biol. 2002;250:231–250. [PubMed] [Full Text]27. Brunet LJ, McMahon JA, McMahon AP, Harland RM. Noggin, cartilage morphogenesis, and joint formation in the mammalian skeleton. Science. 1998;280:1455–1457. [PubMed] [Full Text]28. Gong Y, et al. Heterozygous mutations in the gene encoding noggin affect human joint morphogenesis. Nat. Genet. 1999;21:302–304. [PubMed] [Full Text]29. Brown
DJ, et al. Autosomal dominant stapes ankylosis with broad thumbs and
toes, hyperopia, and skeletal anomalies is caused by heterozygous
nonsense and frameshift mutations in NOG, the gene encoding noggin. Am. J. Hum. Genet. 2002;71:618–624. [Free Full text in PMC]30. Takahashi T, et al. Mutations of the NOG gene in individuals with proximal symphalangism and multiple synostosis syndrome. Clin. Genet. 2001;60:447–451. [PubMed] [Full Text]31. Dixon
ME, Armstrong P, Stevens DB, Bamshad M. Identical mutations in NOG can
cause either tarsal/carpal coalition syndrome or proximal
symphalangism. Genet. Med. 2001;3:349–353. [PubMed] [Full Text]32. Zou
H, Wieser R, Massague J, Niswander L. Distinct roles of type I bone
morphogenetic protein receptors in the formation and differentiation of
cartilage. Genes Dev. 1997;11:2191–2203. [PubMed] [Free Full Text]33. Savarirayan
R, et al. Broad phenotypic spectrum caused by an identical heterozygous
CDMP-1 mutation in three unrelated families. Am. J. Med. Genet. 2003;117A:136–142. 34. Gilboa
L, et al. Bone morphogenetic protein receptor complexes on the surface
of live cells: a new oligomerization mode for serine/threonine kinase
receptors. Mol. Biol. Cell. 2000;11:1023–1035. [Free Full text in PMC]35. Nohe
A, et al. The mode of bone morphogenetic protein (BMP) receptor
oligomerization determines different BMP-2 signaling pathways. J. Biol. Chem. 2002;277:5330–5338. [PubMed] [Free Full Text]36. Keller S, Nickel J, Zhang JL, Sebald W, Mueller TD. Molecular recognition of BMP-2 and BMP receptor IA. Nat. Struct. Mol. Biol. 2004;11:481–488. [PubMed] [Full Text]37. Yokouchi Y, et al. BMP-2/-4 mediate programmed cell death in chicken limb buds. Development. 1996;122:3725–3734. [PubMed] [Free Full Text]38. Hay
E, Lemonnier J, Fromigue O, Marie PJ. Bone morphogenetic protein-2
promotes osteoblast apoptosis through a Smad-independent, protein
kinase C-dependent signaling pathway. J. Biol. Chem. 2001;276:29028–29036. [PubMed] [Free Full Text]39. Thompson
JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X
windows interface: flexible strategies for multiple sequence alignment
aided by quality analysis tools. Nucleic Acids Res. 1997;25:4876–4882. [Free Full text in PMC]40. Goodstadt L, Ponting CP. CHROMA: consensus-based colouring of multiple alignments for publication. Bioinformatics. 2001;17:845–846. [PubMed] [Free Full Text]41. Kelley LA, MacCallum RM, Sternberg MJ. Enhanced genome annotation using structural profiles in the program 3D-PSSM. J. Mol. Biol. 2000;299:499–520. [PubMed] [Full Text]42. Pettersen EF, et al. UCSF Chimera–a visualization system for exploratory research and analysis. J. Comput. Chem. 2004;25:1605–1612. [PubMed] [Full Text]43. Stricker S, Fundele R, Vortkamp A, Mundlos S. Role of Runx genes in chondrocyte differentiation. Dev. Biol. 2002;245:95–108. [PubMed] [Full Text]44. Morgan EA, Nguyen SB, Scott V, Stadler HS. Loss of Bmp7 and Fgf8 signaling in Hoxa13-mutant mice causes hypospadia. Development. 2003;130:3095–3109. [PubMed] [Free Full Text]45. Albrecht
AN, et al. The synpolydactyly homolog (spdh) mutation in the mouse – a
defect in patterning and growth of limb cartilage elements. Mech. Dev. 2002;112:53–67. [PubMed] [Full Text]46. Hughes
SH, Greenhouse JJ, Petropoulos CJ, Sutrave P. Adaptor plasmids simplify
the insertion of foreign DNA into helper-independent retroviral
vectors. J. Virol. 1987;61:3004–3012. [Free Full text in PMC]47. Knaus P, Sebald W. Cooperativity of binding epitopes and receptor chains in the BMP/TGFbeta superfamily. Biol. Chem. 2001;382:1189–1195. [PubMed]48. Ruppert
R, Hoffmann E, Sebald W. Human bone morphogenetic protein 2 contains a
heparin-binding site which modifies its biological activity. Eur. J. Biochem. 1996;237:295–302. [PubMed] |
| | Figure 1Phenotypes of the right hands of patients carrying L441P and R438L mutations. ( A)
The L441P mutation is associated with brachydactyly, characterized by a
short index finger and bending of finger V (clinodactyly). X-rays show
missing middle phalanges in (more ...) |
| Figure 2Protein sequence alignment of GDF5 homologs and 3D models for GDF5 receptor binding. ( A)
Primary sequence alignment of GDF5, BMP2, and BMP4 from different
species, including drosophila DPP. The positions of R438L and L441P
mutations in GDF5 are indicated (more ...) |
| Figure 3Functional analysis of Gdf5 mutants in micromass culture. ( A)
Chicken micromass cultures were assayed after 4 days for extracellular
matrix production and analyzed after 7 days for ALP activity. Cells
were infected with virus containing WT Gdf5 or mutant (more ...) |
| Figure 4Characterization
of ALP induction by GDF5 mutants in chondrogenic ATDC5 cells. ALP
activity was measured after stimulation of ATDC5 cells with increasing
amounts of recombinant proteins after 3 days. ( A) Recombinant BMP2, GDF5, and R438L display characteristic (more ...) |
| Figure 5Effects
of GDF5 mutants on the differentiation of premyoblastic C2C12 cells.
ALP activity was analyzed after stimulation of C2C12 cells with the
recombinant proteins for 3 days. Differentiation markers ALP and myosin
were assayed 5 days after addition (more ...) |
| Figure 6Expression analysis during joint development and overexpression of Gdf5 in vivo. ( A) In situ hybridization on mouse limb sections at E13.5 and E14.5 with probes specific for Gdf5, Bmp2, Nog, Bmpr1a, and Bmpr1b. The area of joint formation is indicated (more ...) |
| Figure 7Schematic drawing of proposed mechanism of metacarpophalangeal joint development and expression of Gdf5, Nog, and Bmp2
in mouse limbs corresponding to E12.5, E13.0, E13.5, and E14.5. Gdf5
induces longitudinal growth at the distal end of each element. (more ...) |
| Table 1 Binding affinities of WT GDF5 and mutant GDF5 to BMPR1A, BMPR1B, and NOG as determined by Biosensor interaction analysis |
|
| |