The tissue inhibitor of metalloproteinases-1 improves migration and adhesion of hematopoietic stem and progenitor cells

• C. Matthias Wilk^{a, ,} ,
• Frank A. Schildberg^{b, c},
• Marcel A. Lauterbach^{d, e},
• Ron-Patrick Cadeddu^a,
• Julia Fröbel^a,
• Volker Westphal^e,
• René H. Tolba^c,
• Stefan W. Hell^e,
• Akos Czibere^a,
• Ingmar Bruns^a,
• Rainer Haas^a

• ^a Department of Hematology, Oncology and Clinical Immunology, Heinrich-Heine-University, Düsseldorf, Germany
• ^b Institute of Molecular Medicine, Rheinische Friedrich-Wilhelms University, Bonn, Germany
• ^c Institute for Laboratory Animal Science and Experimental Surgery, RWTH-Aachen University, Aachen, Germany
• ^d Wavefront Engineering Microscopy Group, Neurophysiology and New Microscopies Laboratory, CNRS UMR8154, INSERM S603, University Paris Descartes, Sorbonne Paris Cité, Paris, France
• ^e Department of NanoBiophotonics, Max Planck Institute for Biophysical Chemistry, Göttingen, Germany

Received 8 September 2012

Revised 22 March 2013

Accepted 23 April 2013

Available online 6 May 2013

The soluble serum tissue inhibitor of metalloproteinases proteins (TIMPs) are expressed both by hematopoietic and stromal cells in the bone marrow (BM) [1]. They were initially described as endogenous inhibitors of matrix metalloproteinases (MMPs), although there is growing evidence for their MMP-independent cytokine-like activities [2].

As MMP-inhibitors, TIMPs participate in the finely regulated remodeling of the BM extracellular matrix (ECM) by inhibiting the degradation of extracellular matrix molecules, such as fibronectin. These ECM components provide structural orientation and growth factors for self-renewal and differentiation of hematopoietic stem and progenitor cells (HSPCs). Regarding the MMP-independent cytokine-like functions in the BM, a recent study has demonstrated a role of endogenous TIMP-1 for the maintenance of hematopoietic stem cell quiescence [3]. However, the effects of exogenous TIMP-1 and its mode of interaction with HSPCs are not well understood.

A previous report has proposed that the tetraspanin CD63 is a cell-surface receptor for TIMP-1 in human breast epithelial cells. In that study, β₁-integrin was activated upon binding of TIMP-1, which promoted cell survival [4]. Numerous reports describe different signaling pathways engaged by TIMP-1 including MAPK and the Wnt/β-catenin pathways 5, 6 and 7. In this report, we show that TIMP-1 binds to CD63 on human CD34⁺ HSPCs, which in turn activates β₁-integrins. Exogenous stimulation of HSPCs with TIMP-1 leads to CD63-dependent activation of β₁-integrin and subsequently increases the migratory and adhesive properties of HSPCs. The results could explain the enhanced homing and short-term engraftment kinetics that we observed in a murine bone marrow transplantation model.

Methods

Human samples and animal experiments

Patients' samples were obtained from healthy donors following G-CSF application for clinical allogenic stem cell transplantation with informed consent. All experiments were approved by the Institutional Review Board of the Heinrich-Heine-University, Düsseldorf, according to the Helsinki Declaration. All animal experiments were performed in accordance with the German law regarding the protection of animals and complied with institution guidelines and the principles of laboratory animal care following The Principles of Laboratory Animal Care (National Institutes of Health publication no. 85-23, revised in 1996). C57BL/6J mice were bred and maintained under specific pathogen-free conditions according to the Federation for Laboratory Animal Science Associations guidelines at the House of Experimental Therapy (Bonn, Germany).

Isolation of mononuclear cells and enrichment of CD34⁺ cells

Peripheral blood mononuclear cells were isolated with density gradient centrifugation using Ficoll-Hypaque (GE Healthcare, München, Germany) as described previously [8]. Subsequent immunomagnetic enrichment of CD34-expressing cells was performed using CD34 microbeads according to the manufacturer's instructions (Miltenyi Biotec, Bergisch-Gladbach, Germany).

Culture conditions of CD34⁺ HSPC for in vitro assays

CD34⁺ HSPCs were cultured in serum-free Hematopoietic Progenitor Growth Medium (HPGM) medium (Lonza, Köln, Germany) supplemented with 10 ng/mL interleukin 3, 10 ng/mL interleukin 6, and 25 ng/mL stem cell factor at 37°C and 5% CO₂ under humidified conditions. CD34⁺ HSPCs were stimulated with 1 nmol/L TIMP-1 for 24 hours and were then used for migration, adhesion, and apoptosis assays with or without signaling pathway inhibitors.

Coimmunoprecipitation

Lysates from CD34⁺ cells were incubated with anti-CD63 antibody (clone MEM259; Abcam, Cambridge, UK) and precipitated using protein A/G- agarose beads (Santa Cruz Biotechnology, Heidelberg, Germany). Eluates were subjected to SDS-PAGE and subsequently transferred to a PVDF membrane that was incubated with a polyclonal anti TIMP-1 antibody (Abcam) and the appropriate HRP-conjugated secondary antibody (Life Technologies, Darmstadt, Germany). The antigen was detected using the ECL Advanced Western Blotting Detection Kit (GE Healthcare, München, Germany).

Stimulated emission depletion microscopy

The principles of stimulated emission depletion (STED) microscopy have been described in detail elsewhere [9]. For staining, CD34⁺ HSPCs were allowed to settle on poly-L-lysine–coated cover slips. Samples were incubated with mouse–anti-CD63, rabbit–anti-TIMP-1 and rabbit–anti-β₁-integrin antibodies (Abcam). Secondary antibodies (Dianova, Hamburg, Germany) were coupled to a Dyomics520XL dye (Dyomics GmbH, Jena, Germany) or a custom made organic dye (KK114). Samples were examined using a home-built STED microscope setup as described previously [10]. Image recording and technical details are described in the supplemental information.

CD63 knockdown

CD63 was knocked down with a small hairpin RNA (shRNA)-based procedure. CD34⁺ cells were transfected with plasmids coding for green fluorescent protein and an shRNA (Origene, Rockville, MD, USA; the shRNA sequence used: AGTATCAGAAGTGGCTACGAGGTGATGTA) using an AMAXA Nucleofection Kit (Lonza, Basel, Switzerland) according to the manufacturer's protocol. Transfected cells were sorted for green fluorescence using a MoFlo XDP sorter (Beckman Coulter, Krefeld, Germany) and then subjected to additional assays.

Quantification of activated β₁-integrin

CD34⁺ HSPCs were stimulated with TIMP-1 for 30 min. The cells were then incubated with a monoclonal antibody exclusively recognizing the activated β₁-integrin (clone HUTS-4; Merck Millipore, Darmstadt, Germany) [11]. Antibody labeling was performed in supplemented HPGM medium (Lonza, Köln, Germany) containing 1 mmol/L Ca²⁺ and 1 mmol/L Mg²⁺ at 37°C for 20 min in the dark as described previously [11].

Migration and adhesion assay

For both assays, CD34⁺ cells were stimulated with TIMP-1 for 24 hours as described earlier. A transwell migration assay was performed with SDF-1α (Peprotech, Hamburg, Germany) as a chemoattractant at a concentration of 100 ng/ml in TIMP-1-free HPGM medium, as previously described with 1 × 10⁵ CD34⁺ cells [12]. The adhesion assay, on fibronectin-coated dishes, was performed as described previously using 2000 cells with an adhesion time of 3 hours in TIMP-1-free HPGM medium [13].

Detection of apoptosis

Apoptosis was induced using staurosporine (R&D Systems, Wiesbaden-Nordenstadt, Germany). After pretreatment with TIMP-1, as described earlier, CD34⁺ cells were incubated with 2 μmol/L staurosporine or dimethyl sulfoxide as a control for 2 hours in a TIMP-1-free supplemented HPGM medium. CD34⁺ cells were then fixed and permeabilized as described previously [14]. Caspase-3 was labeled with a PE-coupled primary monoclonal antibody (clone 5A1E; Cell Signaling Technology, Beverly, MA, USA) and subjected to flow cytometry.